Click HERE to see a full list of HHV-6 & 7 Plasmids available through the
HHV-6 Foundation Repository
pZHV14: This plasmid has a 8.7 Kb Hind III digested fragment of HHV-6 GS strain. This plasmid will be available soon through the HHV-6 Foundation repository. -References: Josephs 1986, Biberfeld 1988, Levine 1992, Saito 1995, Valente 1996, Wagner 1997, Clark 2006, Nacheva 2008, De Pagter 2010, Strenger 2011. Ruth Jarrett (University of Glasgow, UK) has also used pZHV14.
pZVB70: This plasmid contains a 21.4 kb BamHI fragment of the HHV-6 strain GS subcloned into the plasmid vector Bluescript. This plasmid will be available soon through the HHV-6 Foundation repository. -References: Morris 1999, Di Paolo 1994, Torelli 1995, Wagner 1997
Qiagen plasmids: Variant specific probes have also been used which were commercially available through Qiagen as a biotinylated oligoprobe-mixture. The sequences are given by Loginov: HHV-6 variant A (5′-AAAACATTGAAGAAGTTT-3′) and variant B (5′ -AAGACATTGAAGAAGCTT-3′). The probes cover two point mutations creating variant specificity. -References: Loginov 2010, Loginov 2006, Arivananthan 1997, Yadav 1997
CDC plasmids: Several recent papers have used a cocktail of 8 plasmids containing between 9-kb and 16-kb inserts of the HHV-6 genome (nonoverlapping). They were provided by Dr. Scott Schmid, Centers for Disease Control, Atlanta, USA and are now available through the HHV-6 Foundation. A list of the available clones can be found HERE.
Research Genetics/Invitrogen plasmids: This firm (acquired by Invitrogen) prepared an HHV-6 probe, U89. The sequences were 5′ CTTCTGTCCCATCACTGTCAT and 3′ TCAGAGAGTGAAGATGAAG. -References: Glotzbecker 2004 and Roush 2001